CiBE2285, CiBE2285 (genetic_marker) Citrus spp.

Marker Overview
NameCiBE2285
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat Motif(CT)10
Primer 1CiBE2285.Forward Primer: CATACGGTCTCTGCTAAGTGT
Primer 2CiBE2285.Reverse Primer: CATTGCTGATGTGTTGATAAG
Publication[view all]
ContactYong-Sham Kwon
Contact
NameDetails
Yong-Sham Kwon
First name:Yong-Sham
Last name:Kwon
Title:Researcher
Institution:Dong-A University
Address:Department of Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea
Country:Korea
Email:yskwon3@dau.ac.kr
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCiBE2285.Forward PrimerCitrus spp.primer
Reverse PrimerCiBE2285.Reverse PrimerCitrus spp.primer