35S, 35S (genetic_marker) Citrus spp.

Marker Overview
Name35S
Genbank IDN/A
Typegene marker
SpeciesCitrus spp.
Primer 135S.Forward Primer: ATCTCCACTGACGTAAGGGATGACG
Publication[view all]
ContactTomoko Endo
Contact
NameDetails
Tomoko Endo
First name:Tomoko
Last name:Endo
Title:Researcher
Institution:Shizuoka University
Address:Faculty of Agriculture, Shizuoka University, Sizuoka, Shizuoka 422-8529, Japan
Country:Japan
Email:tomoen@affrc.go.jp
Last update:May 2020
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward Primer35S.Forward PrimerCitrus spp.primer