CsLFY, CsLFY (genetic_marker) Citrus spp.

Marker Overview
NameCsLFY
Genbank IDAY338976
TypePCR marker
SpeciesCitrus spp.
Primer 1CsLFY.Forward Primer: TCTTGATCCAGGTCCAGAACATC
Primer 2CsLFY.Reverse Primer: TAGTCACCTTGGTTGGGCATT
Publication[view all]
ContactFumie Nishikawa
Contact
NameDetails
Fumie Nishikawa
First name:Fumie
Last name:Nishikawa
Title:Researcher
Institution:National Agricultural Research Organization
Address:Okitsu Citrus Research Station, National Institute of Fruit Tree Science, National Agricultural Research Organization, 424-0292 Okitsu Shimizu-ku, Shizuoka, Japan
Country:Japan
Email:fumien@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCsLFY.Forward PrimerCitrus spp.primer
Reverse PrimerCsLFY.Reverse PrimerCitrus spp.primer