sinensis_213830_contig11118_p335_GA, sinensis_213830_contig11118_p335_GA (genetic_marker) Citrus spp.

Marker Overview
Namesinensis_213830_contig11118_p335_GA
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1sinensis_213830_contig11118_p335_GA.Forward Primer: GAAGCTGGCGTCACAGAGTT
Primer 2sinensis_213830_contig11118_p335_GA.Reverse Primer: ATCCAGTAGGCAATGCAACC
Primer 3sinensis_213830_contig11118_p335_GA.SBE Primer: CGTGAATGCCTCTACCTTGAA
Publication[view all]
ContactChunxian Chen
Contact
NameDetails
Chunxian Chen
First name:Chunxian
Last name:Chen
Title:Researcher
Institution:UFL
Address:University of Florida, IFAS, Citrus Research and Education Center,700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:cxchen@crec.ifas.ufl.edu
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward Primersinensis_213830_contig11118_p335_GA.Forward PrimerCitrus spp.primer
Reverse Primersinensis_213830_contig11118_p335_GA.Reverse PrimerCitrus spp.primer
SBE Primersinensis_213830_contig11118_p335_GA.SBE PrimerCitrus spp.primer


Sequence
>sinensis_213830_contig11118_p335_GA ID=sinensis_213830_contig11118_p335_GA|Name=sinensis_213830_contig11118_p335_GA|organism=Citrus spp.|type=genetic_marker|length=25bp
CTCTTCTATGTTGTTCAAGGTAGAG