Af1109, Af1109 (genetic_marker) Citrus spp.

Name	Af1109
Genbank ID	forward primer
Type	CAPS
Species	Citrus spp.
Primer 1	Af1109.Forward Primer: ACAATGGGGCTTTAGA
Primer 2	Af1109.Reverse Primer: TATCTTCGTTTCTTCATGCGT
Product Length	1200
Restriction Enzyme	Msp1
Publication	[view all]
Contact	Mitsuo Omura

Name	Details
Mitsuo Omura	First name: Mitsuo Last name: Omura Title: Researcher Institution: NARO Institute of Fruit Tree Science Address: Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan Country: Japan Email: amomura@ipc.shizuoka.ac.jp

This genetic_marker is adjacent to the following primer feature(s):

Feature Name	Unique Name	Species	Type
Forward Primer	Af1109.Forward Primer	Citrus spp.	primer
Reverse Primer	Af1109.Reverse Primer	Citrus spp.	primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature Name	Unique Name	Species	Type
Af1109a	Af1109a	Citrus spp.	marker_locus

Year	Publication
2014	Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014	AGI-05	N/A	48.6	Af1109a	View