|
Marker Overview
Name | Af1109 |
Genbank ID | forward primer |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Af1109.Forward Primer: ACAATGGGGCTTTAGA |
Primer 2 | Af1109.Reverse Primer: TATCTTCGTTTCTTCATGCGT |
Product Length | 1200 |
Restriction Enzyme | Msp1 |
Publication | [view all] |
Contact | Mitsuo Omura
|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
Forward Primer | Af1109.Forward Primer | Citrus spp. | primer |
Reverse Primer | Af1109.Reverse Primer | Citrus spp. | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Feature Name | Unique Name | Species | Type |
Af1109a | Af1109a | Citrus spp. | marker_locus |
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
|