|
|
Marker Overview
| Name | Al0524 |
|---|
| Genbank ID | C95551 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Al0524.Forward Primer: GAACTTCCGTCCAGATAGTGT |
|---|
| Primer 2 | Al0524.Reverse Primer: CCTTGGCCATTTTCATTG |
|---|
| Product Length | 1800 |
|---|
| Restriction Enzyme | Hha1 |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
Mitsuo Omura
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2016 | Sharafi AA, Abkenar AA, Sharafi A, Masaeli M. Genetic variation assessment of acid lime accessions collected from south of Iran using SSR and ISSR molecular markers. Physiology and molecular biology of plants : an international journal of functional plant biology. 2016 Jan; 22(1):87-95. |
|
