Bf0171, Bf0171 (genetic_marker) Citrus spp.

Marker Overview
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1Bf0171.Forward Primer: GTGGAGTTGCCTGGTTCTTG
Primer 2Bf0171.Reverse Primer: GAATTGGCATGGGAAAACAGA
Product Length400
Restriction EnzymeSI381
Publication[view all]
ContactMitsuo Omura
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0171.Forward PrimerCitrus spp.primer
Reverse PrimerBf0171.Reverse PrimerCitrus spp.primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0171gBf0171gCitrus spp.marker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer