Fb0233, Fb0233 (genetic_marker) Citrus spp.

Marker Overview
NameFb0233
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1Fb0233.Forward Primer: CTAGGGCATGAAGACACTGTT
Primer 2Fb0233.Reverse Primer: AAGCTCAGCCAAAACCTC
Product Length2200
Restriction EnzymeSI025
Publication[view all]
ContactMitsuo Omura
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerFb0233.Forward PrimerCitrus spp.primer
Reverse PrimerFb0233.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Fb0233aFb0233aCitrus spp.marker_locus
Fb0233Fb0233Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014AGI-02N/A47.4Fb0233aView
2Citrus-Hyuganatsu/2-11-BC1LG02N/A58.5Fb0233View