Wy0029, Wy0029 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	Wy0029
Genbank ID	forward primer
Type	CAPS
Species	Citrus spp.
Primer 1	Wy0029.Forward Primer: GCTTCCGCTTTACCTCAGTCT
Primer 2	Wy0029.Reverse Primer: TCAAAACCCGAAACACGAGT
Product Length	900
Restriction Enzyme	Sty1
Publication	[view all]
Contact	Mitsuo Omura

Contact

Name

Details

Mitsuo Omura

First name:	Mitsuo
Last name:	Omura
Title:	Researcher
Institution:	NARO Institute of Fruit Tree Science
Address:	Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:	Japan
Email:	amomura@ipc.shizuoka.ac.jp

Publications


Year	Publication
2014	Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013.