|
Marker Overview
Name | Al0231 |
Genbank ID | C95289 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Al0231.Forward Primer: CAGAAAGCTCAAGCCAAAG |
Primer 2 | Al0231.Reverse Primer: ACATTAGCTAGCGAAAACCAC |
Restriction Enzyme | HaeIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Zandalinas SI, Rivero RM, Martínez V, Gómez-Cadenas A, Arbona V. Tolerance of citrus plants to the combination of high temperatures and drought is associated to the increase in transpiration modulated by a reduction in abscisic acid levels. BMC plant biology. 2016; 16(1):105. |
|