|
|
Marker Overview
| Name | Bf0021 |
|---|
| Genbank ID | DC885105 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0021.Forward Primer: GGCCTCTATAATGATGTGCTT |
|---|
| Primer 2 | Bf0021.Reverse Primer: CGGTCGTCCTCCCTCTT |
|---|
| Restriction Enzyme | MspI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Sassi AH, Tounsi H, Trigui-Lahiani H, Bouzouita R, Romdhane ZB, Gargouri A. A low-temperature polygalacturonase from P.occitanis: characterization and application in juice clarification. International journal of biological macromolecules. 2016 May 24. |
|
