|
|
Marker Overview
| Name | Sz0011 |
|---|
| Genbank ID | N/A |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Sz0011.Forward Primer: TCGGCTTTGCAAGAGTGTT |
|---|
| Primer 2 | Sz0011.Reverse Primer: CCGAGGTACATCTCAATTGGG |
|---|
| Restriction Enzyme | NdeII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Ziogas V, Tanou G, Belghazi M, Diamantidis G, Molassiotis A. Characterization of β-amino- and γ-amino butyric acid-induced citrus seeds germination under salinity using nanoLC-MS/MS analysis. Plant cell reports. 2016 Oct 19. |
|
