Lp0221

Marker Overview
NameLp0221
Genbank IDN/A
TypeCAPS
SpeciesCitrus spp.
Primer 1Lp0221.Forward: GTTTAGGTACGGGTGGGTCTG
Primer 2Lp0221.Reverse: GGTGTAAGTTGCCGACGGTA
Product Length1200
Publication[view all]
ContactTomoko Endo
Contact
NameDetails
Tomoko Endo
First name:Tomoko
Last name:Endo
Title:Researcher
Institution:Shizuoka University
Address:Faculty of Agriculture, Shizuoka University, Sizuoka, Shizuoka 422-8529, Japan
Country:Japan
Email:tomoen@affrc.go.jp
Last update:May 2020
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardLp0221.ForwardCitrus spp.primer
ReverseLp0221.ReverseCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Lp0221Lp0221Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Hyuganatsu/2-11-BC1LG01N/A19.7Lp0221View