FC872963

Overview
NameFC872963
Unique NameFC872963
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length759
Libraries
Library NameType
AbsDevcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FAR1_ARATH (Protein FAR-RED IMPAIRED RESPONSE 1 OS=Arabidopsis thaliana GN=FAR1 PE=1 SV=1)

HSP 1 Score: 196.052 bits (497), Expect = 1.803e-49
Identity = 108/231 (46.75%), Postives = 149/231 (64.50%), Query Frame = 2
Query:   83 GDEINLNSIKTIEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLG-NSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQ-----HLALEEGDAQVMLDHFMHMQDENPNFFY 757
            G ++  +    +EP  G++F++ E A+ FY+EYAKS+GF T IK SRRS+ +  FIDAKF C+RYG   ES +  S+               +R  +     KTDCKA MHVKRR  DG+WII  F+K+HNHE+ P  AY+FR  RN+ L   +N D LHA+ ERTK+M+V MSR+SGG+K +    GS++   VS+Q     +LALEEGD+QV+L++F  ++ ENP FFY
Sbjct:   38 GGDVGFSGDLDLEPRNGIDFDTHEAAYIFYQEYAKSMGFTTSIKNSRRSKKTKDFIDAKFACSRYGVTPESESSGSS--------------SRRSTV----KKTDCKASMHVKRR-PDGKWIIHEFVKDHNHELLPALAYHFRIQRNVKLAEKNNIDILHAVSERTKKMYVEMSRQSGGYKNI----GSLLQTDVSSQVDKGRYLALEEGDSQVLLEYFKRIKKENPKFFY 245          
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FRS1_ARATH (Protein FAR1-RELATED SEQUENCE 1 OS=Arabidopsis thaliana GN=FRS1 PE=1 SV=1)

HSP 1 Score: 191.43 bits (485), Expect = 4.441e-48
Identity = 112/211 (53.08%), Postives = 134/211 (63.51%), Query Frame = 2
Query:  128 EGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRES-STVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFY 757
            EG EFESKEEAF FYKEYA SVGF TIIKASRRSR++GKFIDAKFVCTRYG+K+E   T   T+  N      IP  +KRGRINRS SKTDCKA +HVKRRQ DGRW++RS +KEHNHEIF  QA                D+L               R+  G +KL+   G++V  + S +   LE+GD + +L+ F  MQ ENP FFY
Sbjct:   23 EGREFESKEEAFEFYKEYANSVGFTTIIKASRRSRMTGKFIDAKFVCTRYGSKKEDIDTGLGTDGFN------IPQARKRGRINRSSSKTDCKAFLHVKRRQ-DGRWVVRSLVKEHNHEIFTGQA----------------DSL---------------RELSGRRKLEKLNGAIVKEVKSRK---LEDGDVERLLNFFTDMQVENPFFFY 192          
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FRS4_ARATH (Protein FAR1-RELATED SEQUENCE 4 OS=Arabidopsis thaliana GN=FRS4 PE=2 SV=1)

HSP 1 Score: 166.392 bits (420), Expect = 1.530e-40
Identity = 92/208 (44.23%), Postives = 123/208 (59.13%), Query Frame = 2
Query:  134 MEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFY 757
            MEFE+ E+A+ FYK+YAKSVGF T   +SRRSR S +FIDAKF C RYG+K++S      + IN                 R+  K  CKA MHVKRR  DG+W + SF+KEHNH++ P+QA+YFR HRN +L  SN   L     R K   +T  +    +  LD   G + N     + L L+ GDA+++L+  M MQ+ENP FF+
Sbjct:    1 MEFETHEDAYLFYKDYAKSVGFGTAKLSSRRSRASKEFIDAKFSCIRYGSKQQSD-----DAIN----------------PRASPKIGCKASMHVKRR-PDGKWYVYSFVKEHNHDLLPEQAHYFRSHRNTELVKSNDSRL----RRKKNTPLTDCKHLSAYHDLDFIDGYMRNQHDKGRRLVLDTGDAEILLEFLMRMQEENPKFFF 182          
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FHY3_ARATH (Protein FAR-RED ELONGATED HYPOCOTYL 3 OS=Arabidopsis thaliana GN=FHY3 PE=1 SV=1)

HSP 1 Score: 154.066 bits (388), Expect = 7.858e-37
Identity = 85/225 (37.78%), Postives = 126/225 (56.00%), Query Frame = 2
Query:   83 GDEINLNSIKTIEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFY 757
            G+ +       +EPL GMEFES  EA+SFY+EY++++GF T I+ SRRS+ + +FIDAKF C+RYG KRE     +              +   GR  R+ +KTDCKA MHVKRR  DG+W+I SF++EHNHE+ P Q                     A+ E+T++++  M+++   +K +   K    +     + L++E GD +++LD    MQ  N NFFY
Sbjct:   57 GELVEYTEGMNLEPLNGMEFESHGEAYSFYQEYSRAMGFNTAIQNSRRSKTTREFIDAKFACSRYGTKREYDKSFNRPRARQSKQDP---ENMAGR--RTCAKTDCKASMHVKRR-PDGKWVIHSFVREHNHELLPAQ---------------------AVSEQTRKIYAAMAKQFAEYKTVISLKSDSKSSFEKGRTLSVETGDFKILLDFLSRMQSLNSNFFY 254          
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FRS2_ARATH (Protein FAR1-RELATED SEQUENCE 2 OS=Arabidopsis thaliana GN=FRS2 PE=2 SV=1)

HSP 1 Score: 140.198 bits (352), Expect = 1.174e-32
Identity = 89/222 (40.09%), Postives = 114/222 (51.35%), Query Frame = 2
Query:   95 NLNSIKTIEPLE-GMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFY 757
            N+    T+  L  GM+FESKE A+ FY+EYA+SVGF   IKASRRS+ SGKFID K  C+R+G KRE +T      IN                 RS  KT CKA +H+KR+ ED +W+I +F+KEHNHEI PD  Y          G + P    AI++                                   LALEE D +++L+HFM MQD+ P FFY
Sbjct:   28 NVAQCATVSELRNGMDFESKEAAYYFYREYARSVGFGITIKASRRSKRSGKFIDVKIACSRFGTKREKAT-----AIN----------------PRSCPKTGCKAGLHMKRK-EDEKWVIYNFVKEHNHEICPDDFYV------SVRGKNKPAGALAIKK--------------------------------GLQLALEEEDLKLLLEHFMEMQDKQPGFFY 189          
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FRS5_ARATH (Protein FAR1-RELATED SEQUENCE 5 OS=Arabidopsis thaliana GN=FRS5 PE=2 SV=1)

HSP 1 Score: 124.405 bits (311), Expect = 6.668e-28
Identity = 72/218 (33.03%), Postives = 118/218 (54.13%), Query Frame = 2
Query:  116 IEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYG--NKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIF-PDQAYYFRGHRNLD-LGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFY 757
            +EP +G+EFES+E A +FY  YA+ +GF+T + +SRRSR  G  I  +FVC + G  N  E  T                 K +  +  R+ ++  CKA + VK  Q+ G+W++  F+K+HNHE+  PDQ +  R HR +     +  D L A     +R+   + ++ GG  K+   +    N++ + +  ++ EG+ Q++LD+   M  +NPNFFY
Sbjct:   71 LEPYDGLEFESEEAAKAFYNSYARRIGFSTRVSSSRRSRRDGAIIQRQFVCAKEGFRNMNEKRT-----------------KDREIKRPRTITRVGCKASLSVK-MQDSGKWLVSGFVKDHNHELVPPDQVHCLRSHRQISGPAKTLIDTLQAAGMGPRRIMSALIKEYGGISKVGFTEVDCRNYMRNNRQKSI-EGEIQLLLDYLRQMNADNPNFFY 269          
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FRS7_ARATH (Protein FAR1-RELATED SEQUENCE 7 OS=Arabidopsis thaliana GN=FRS7 PE=2 SV=1)

HSP 1 Score: 72.7886 bits (177), Expect = 2.302e-12
Identity = 57/217 (26.27%), Postives = 86/217 (39.63%), Query Frame = 2
Query:  110 KTIEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLD-HQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFY 757
            K  EP  G+EF S  EA  FY+ YA+ VGF   I    RS++ G     +FVC++ G +                                 S+  C A M +K RQ+ G WI+    K+HNH++ P       G +N  +     D                   +GG   +D  +   + NH+ S +   + +    V+LD+F   Q E+  FFY
Sbjct:  186 KATEPYAGLEFNSANEACQFYQAYAEVVGFRVRIGQLFRSKVDGSITSRRFVCSKEGFQHP-------------------------------SRMGCGAYMRIK-RQDSGGWIVDRLNKDHNHDLEP-------GKKNAGMKKITDDV------------------TGGLDSVDLIELNDLSNHISSTRENTIGKEWYPVLLDYFQSKQAEDMGFFY 345          
BLAST of FC872963 vs. ExPASy Swiss-Prot
Match: FRS8_ARATH (Protein FAR1-RELATED SEQUENCE 8 OS=Arabidopsis thaliana GN=FRS8 PE=2 SV=1)

HSP 1 Score: 71.633 bits (174), Expect = 5.129e-12
Identity = 57/221 (25.79%), Postives = 94/221 (42.53%), Query Frame = 2
Query:  122 PLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNS-----NPDALHAIRERTKRMFVTMSRKS----GGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFY 757
            P  GMEFES ++A+SFY  YA+ +GFA  +K+S   R S +   A   C   G K                        K     R  ++T C+A + ++    D RW +     +HNH   P +A+  + H+      S     NP+    ++ RT +++ T++  +    G            ++H  S++ L L  G  + + D F  +Q  +PNF Y
Sbjct:   66 PTPGMEFESYDDAYSFYNSYARELGFAIRVKSSWTKRNSKEKRGAVLCCNCQGFK----------------------LLKDAHSRRKETRTGCQAMIRLRLIHFD-RWKVDQVKLDHNHSFDPQRAHNSKSHKKSSSSASPATKTNPEPPPHVQVRTIKLYRTLALDTPPALGTSLSSGETSDLSLDHFQSSRRLEL-RGGFRALQDFFFQIQLSSPNFLY 262          
The following BLAST results are available for this feature:
BLAST of FC872963 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 8
Match NameE-valueIdentityDescription
FAR1_ARATH1.803e-4946.75Protein FAR-RED IMPAIRED RESPONSE 1 OS=Arabidopsis... [more]
FRS1_ARATH4.441e-4853.08Protein FAR1-RELATED SEQUENCE 1 OS=Arabidopsis tha... [more]
FRS4_ARATH1.530e-4044.23Protein FAR1-RELATED SEQUENCE 4 OS=Arabidopsis tha... [more]
FHY3_ARATH7.858e-3737.78Protein FAR-RED ELONGATED HYPOCOTYL 3 OS=Arabidops... [more]
FRS2_ARATH1.174e-3240.09Protein FAR1-RELATED SEQUENCE 2 OS=Arabidopsis tha... [more]
FRS5_ARATH6.668e-2833.03Protein FAR1-RELATED SEQUENCE 5 OS=Arabidopsis tha... [more]
FRS7_ARATH2.302e-1226.27Protein FAR1-RELATED SEQUENCE 7 OS=Arabidopsis tha... [more]
FRS8_ARATH5.129e-1225.79Protein FAR1-RELATED SEQUENCE 8 OS=Arabidopsis tha... [more]
back to top
Properties
Property NameValue
Genbank descriptionKN0AAI3DH06FM1 AbsDev Citrus clementina cDNA clone KN0AAI3DH06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872963 ID=FC872963; Name=FC872963; organism=Citrus clementina; type=EST; length=759bp
AAATGTCTCTGATAATAATAAGGAAAATACTAGACCTAAGATTAGTAGAA
CAGTGGTAGATGGTAGACAGAAAGCTTATGCTGGAGATGAAATTAACCTG
AATTCCATTAAAACTATAGAGCCTCTAGAGGGAATGGAATTTGAATCGAA
GGAAGAAGCATTTTCTTTTTATAAAGAGTATGCTAAGTCAGTGGGTTTTG
CCACCATTATAAAAGCTAGCCGTCGATCAAGAATATCTGGAAAATTTATT
GATGCCAAATTTGTATGTACTAGGTACGGAAATAAGCGAGAATCAAGTAC
GGTAGAATCTACAGAAGTCATCAATATGGATAGTATGACAGGCATTCCCA
TTAAGAAGAAACGGGGTAGAATTAATCGGTCTTGGTCAAAAACTGATTGC
AAGGCTTGCATGCATGTGAAGAGAAGGCAAGAAGATGGAAGATGGATTAT
TCGCAGTTTCATAAAGGAGCATAACCATGAAATATTCCCAGACCAGGCAT
ATTACTTTCGGGGTCATAGGAATTTAGATCTAGGTAATAGTAATCCTGAT
GCCTTGCATGCAATCCGGGAGAGAACAAAAAGAATGTTCGTCACAATGTC
TAGAAAATCTGGCGGGCATAAGAAACTAGATCATCAGAAAGGAAGTGTTG
TAAATCATTTAGTAAGTGCTCAACATTTAGCTTTAGAGGAAGGAGATGCT
CAAGTTATGCTTGATCATTTTATGCATATGCAAGATGAGAATCCTAACTT
CTTTTATGC
back to top