|
|
Marker Overview
| Name | NPF5.12 |
|---|
| Genbank ID | N/A |
|---|
| Type | SCAR |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | NPF5.12.Forward primer: CACGCACCAATATCCAAAGA |
|---|
| Primer 2 | NPF5.12.Reverse primer: TTTCGATGCCATCAATTCTG |
|---|
| Publication | [view all] |
|---|
| Contact | Maria J. Asins
|
|---|
Publications
| Year | Publication |
|---|
| 2023 | Asins MJ, Bullones A, Raga V, Romero-Aranda MR, Espinosa J, Triviño JC, Bernet GP, Traverso JA, Carbonell EA, Claros MG, Belver A. Combining Genetic and Transcriptomic Approaches to Identify Transporter-Coding Genes as Likely Responsible for a Repeatable Salt Tolerance QTL in Citrus.. International journal of molecular sciences. 2023 Oct 30; 24(21). |
|
