DR406040

Overview
NameDR406040
Unique NameDR406040
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length623
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Properties
Property NameValue
Genbank descriptionCSAJ-PNP1248I15 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone CSAJ-PNP1248I15 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR406040 ID=DR406040|Name=DR406040|organism=Citrus sinensis|type=EST|length=623bp
GGGGGGGATGAATAAACTCGTGTAAGATGAAAAAAATATCAGAGGATGAT
ANNNNNNNCTAAGTCGAAAAGCGCAGGCAACAACAGTTGAACGCCGTTCG
GCTAAATCCCTAACTGTTGAACGTCGTTCGGCTTGCAGTCGCCGTCATCG
AACGCCGAATGCCTCGCCTGACCTGAGCACACGTTGTTGTCGTCGAAGGT
CAAACGTCGGCTGCCCTGCGTCGCCTCGCTCAGCACACTTCGCCGTCATC
AAACGTCAGCAACCCTCTACATCTTGGCTCCCGTGAAACACACCGTGCTT
GGCTGCCTTGTCCATTCTTTCCACTAATCCATTGTTGGTCGCTGTTAACA
CAAAAGGTGAGCGCAATTTTCCAGCAAATCAATTTTTGATTTTAAGTGAA
TTAATACCTATAAGGATAAATGCATAAATGTAGTTTCTAATTTGTAGTAT
TTTTTATTCGTGGATTTTAATGGTTGTATACTTTAATTTAGTTATTTTTT
GTGTTTGATTTATATTGTGATATTTTTATTTGTGGATTTTATGATGATGT
TGTATTTTTTTCATGTTAAATTGTTAATTGTTGGGTTGTAATCGAAAAAA
AAAAAAAAAAAAAAAAAAAAAAA
back to top