DR405953

Overview
NameDR405953
Unique NameDR405953
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length765
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig651 contig Csv1_Contig651:90..854. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCSAJ-PNP1248E13 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone CSAJ-PNP1248E13 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR405953 ID=DR405953|Name=DR405953|organism=Citrus sinensis|type=EST|length=765bp
GGGGGGAACGTGAAAAAATGGAGAGTTTTTGGAACAAAGCCAAAACCTTC
GCGGAAGAAGCGGCGAATAAGTCTCAATCCCTGACGAACTCCACGAAAAT
CGCCGATCTGTTCGCCGAGACTGCTAAAAAGTCTAAAGAATTCGCGCTGG
AGGCGTCGAAGAAAGCCGATGAGTTCAAAACGGCGGCGCTTAAGCAAGCC
GATCAGATCCCTATCAAGTCAATCACCGACATCATTCCGCCTCAGCTCGC
CTCCTCTTTATCGTCCATTGCCAGCTCTTCCTCCGGCCCCACCGCCTCGG
ATTTGGAGCTTCAGAAGTTCGGCATCACCGATGACTTGAGAGACTTTGTT
AAAGGACTCACTTCTAGTACATTCCAGAACTTTCCTATTCAAGATGAAGC
TGAGGCCTCTGATGTGCCAAACACGACGTCGAATGTACGGAAGGATCTGA
CGGGGTGGCAAGAGAGACATGCCACGCTTGTTCTCGCCACTGTCAAGGGG
ATCTCCAAGTTAAGATATGAATTATGTCCACGTGTTATGAAAGAAAGGAA
ATTCTGGAAGATATATTTTACCCTTGTGAGCACTCACGTGGCTCCGTACG
AGAAGCAGTACATGGAAGAGATTAAGCTCAAAGATGAAAAGAAGATGACA
GATGATACTGTGAAGCCAACTCCAATTGTTGGGGAAACTAGTAAATCAGA
GGTTACAGAGAAGAACTTGAAAAGTAGGACTTCAACTTCCTCATNCATTG
AGCAGGACTTGGATA
back to top