DN134768

Overview
NameDN134768
Unique NameDN134768
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length430
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in Vulnus5 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:409..838. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca01a11 Developing fruit albedo at 80 DAFB in Vulnus5 vector Citrus sinensis cDNA clone wca01a11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN134768 ID=DN134768|Name=DN134768|organism=Citrus sinensis|type=EST|length=430bp
CCGGGGGCTCAGTACTTATTTTTTATATAGTGCACTCGAAGCTAGCAAAG
ATCTTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAG
CGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATG
ATGTTGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGA
AATCCTGATTATTATGGGTAAGTGTCTACAATCTGGATGATGATATATAT
AATTAAATAAAAAGATGGGTACAGTTATTACCTATCAATTATAAGAGTGT
CAATTTAGTTCAGTTCACTTACAAAAATCTCTTATAAAAGAGATTATCTT
TGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTG
TAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top