DT214564

Overview
NameDT214564
Unique NameDT214564
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length303
Properties
Property NameValue
Genbank descriptionUCRCS10_20E06_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-20E06-J12-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214564 ID=DT214564|Name=DT214564|organism=Citrus sinensis|type=EST|length=303bp
GGGATAATATAATTATTTAGCACAAGGTCCTCTTTATGGGCAACCCCTTT
GCGCACTCCATCGATTATTCATTGTAATCCTTCACATTACATAGAAACAA
ATAGGAGACTTATTGAGGGAGATAACCCGACTTCCTACCACACTTGATTG
AATCATCTAATATCATTTGCAAATCATACTTGTATTCAAATCCATTCTCT
GCAAGCTTCGGTCCGCCCCATTTAATTTCCCTTTTTGGCACATATCAAGA
CCTGAAACAAAATTATTTTTGTCAATTTACTGCACTTAAGTAAAGTGAGA
CCT
back to top