|
|
Marker Overview
| Name | Al0324 |
|---|
| Genbank ID | C95353 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Al0324.Forward Primer: CCTCTGGTTCTTCCGTTAC |
|---|
| Primer 2 | Al0324.Reverse Primer: TATGAATTCGGCATTTAGGAC |
|---|
| Product Length | 1200 |
|---|
| Restriction Enzyme | Dra1 |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
Mitsuo Omura
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2016 | Jin XL, Ma CL, Yang LT, Chen LS. Alterations of physiology and gene expression due to long-term magnesium-deficiency differ between leaves and roots of Citrus reticulata. Journal of plant physiology. 2016 May 4; 198:103-115. |
|
