|
|
Marker Overview
| Name | Fb0326 |
|---|
| Genbank ID | DC888265 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Fb0326.Forward Primer: CCAAACTGGAGAGAACATTC |
|---|
| Primer 2 | Fb0326.Reverse Primer: ATAGACTCCTCCGCTACAGAA |
|---|
| Product Length | 1200 |
|---|
| Restriction Enzyme | Msp1 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Playdon MC, Sampson JN, Cross AJ, Sinha R, Guertin KA, Moy KA, Rothman N, Irwin ML, Mayne ST, Stolzenberg-Solomon R, Moore SC. Comparing metabolite profiles of habitual diet in serum and urine. The American journal of clinical nutrition. 2016 Aug 10. |
|
