|
|
Marker Overview
| Name | Fb0153 |
|---|
| Genbank ID | DC888071 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Fb0153.Forward Primer: CTTTGGCGTCACTTGA |
|---|
| Primer 2 | Fb0153.Reverse Primer: TGTCCCAAAAATCTGTAGTTA |
|---|
| Product Length | 1400 |
|---|
| Restriction Enzyme | Hinc2 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Taverna D, Di Donna L, Mazzotti F, Tagarelli A, Napoli A, Furia E, Sindona G. Rapid discrimination of bergamot essential oil by paper spray mass spectrometry and chemometric analysis. Journal of mass spectrometry : JMS. 2016 Jul 27. |
|
