CT02, CT02 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	CT02
Genbank ID	N/A
Type	SSR
Species	Citrus spp.
Repeat Motif	CT
Primer 1	CT02.Forward Primer: ACGGTGCGTTTTGAGGTAAG
Primer 2	CT02.Reverse Primer: TGACTGTTGGATTTGGGATG
Publication	[view all]
Contact	Noelle Barkley Behrouz Golein Osman Gulsen Qi-bin Hong

Contact

Name

Details

Noelle Barkley

First name:	Noelle
Last name:	Barkley
Title:	Researcher
Institution:	University of California, Riverside
Address:	Department of Botany and Plant Sciences and Graduate Program in Genetics, Genomics, and Bioinformatics, University of California, Riverside, USA
Country:	USA
Email:	nbarkley@ars-grin.gov
Phone:	+1-770-4124035
Fax:	+ 1-770-2293323

Behrouz Golein

First name:	Behrouz
Last name:	Golein
Title:	Researcher
Institution:	Iran Citrus Research Institute
Address:	Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:	Iran
Email:	bgoleincitrus@yahhoo.com
Phone:	+98 9113945261
Fax:	+98 1925223282

Osman Gulsen

First name:	Osman
Last name:	Gulsen
Title:	Researcher
Institution:	Erciyes University, Turkey
Address:	Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:	Turkey
Email:	o_gulsen@yahoo.com
Phone:	+90 352 4374901
Fax:	+90 352 4376902

Qi-bin Hong

First name:	Qi-Bin
Last name:	Hong
Title:	Researcher
Institution:	Chinese Academy of Agricultural Sciences/Southwest University
Address:	Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:	China
Email:	hongqb@sina.com

Publications


Year	Publication
2006	Barkley N, Roose M, Krueger R, Federici C. Assessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs). Theoretical and applied genetics. 2006; 112(8):1519-1531.
2012	Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2010	Gulsen O, Uzun A, Canan I, Seday U, Canihos E. A new citrus linkage map based on SRAP, SSR, ISSR, POGP, RGA and RAPD markers. Euphytica. 2010; 173(2):265-277.
2015	Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Citrus-Orlando/Clementine-F1-Orlando-2010	Orl-9	N/A	27	SSRCT02.100	View
2	Citrus-Li2/Wan2-F1-2015	LG5	N/A	16.4	CT02	View