|
|
Marker Overview
| Name | Bf0013 |
|---|
| Genbank ID | DC885053 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0013.Forward Primer: CAGAAGTGGGCTGGAA |
|---|
| Primer 2 | Bf0013.Reverse Primer: ATACAATAGAAAATCGCAACA |
|---|
| Product Length | 1050 |
|---|
| Restriction Enzyme | Hinf1 |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
Mitsuo Omura
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2016 | Martins PM, Machado MA, Silva NV, Takita MA, de Souza AA. Type II Toxin-Antitoxin Distribution and Adaptive Aspects on Xanthomonas Genomes: Focus on Xanthomonas citri. Frontiers in microbiology. 2016; 7:652. |
|
