|
|
Marker Overview
| Name | Sz0017 |
|---|
| Genbank ID | N/A |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Sz0017.Forward Primer: ACACCAAGGCAAAAGTTTCTAGGTT |
|---|
| Primer 2 | Sz0017.Reverse Primer: GCCGAGGTACATTAATATTGCAAG |
|---|
| Restriction Enzyme | NdeII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Alcántara-de la Cruz R, Fernández-Moreno PT, Ozuna CV, Rojano-Delgado AM, Cruz-Hipolito HE, Domínguez-Valenzuela JA, Barro F, De Prado R. Target and Non-target Site Mechanisms Developed by Glyphosate-Resistant Hairy beggarticks (Bidens pilosa L.) Populations from Mexico. Frontiers in plant science. 2016; 7:1492. |
|
