|
|
Marker Overview
| Name | Tf0226 |
|---|
| Genbank ID | CF508769 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Tf0226.Forward Primer: CTCTGGCAACAACAAGTGTCA |
|---|
| Primer 2 | Tf0226.Reverse Primer: CGGTGCTCTCCTTCGTA |
|---|
| Restriction Enzyme | HaeIII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Gois IB, Borém A, Cristofani-Yaly M, de Resende MD, Azevedo CF, Bastianel M, Novelli VM, Machado MA. Genome wide selection in Citrus breeding. Genetics and molecular research : GMR. 2016 Oct 17; 15(4). |
|
