|
|
Marker Overview
| Name | Al0304 |
|---|
| Genbank ID | C95332 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Al0304.Forward Primer: CGCAGATACCAGACACCAG |
|---|
| Primer 2 | Al0304.Reverse Primer: GAGAAACCTCCGCATAATGAT |
|---|
| Product Length | 450 |
|---|
| Restriction Enzyme | Nde2 |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
Mitsuo Omura
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2016 | Lai KK, Davis-Richardson AG, Dias R, Triplett EW. Identification of the Genes Required for the Culture of Liberibacter crescens, the Closest Cultured Relative of the Liberibacter Plant Pathogens. Frontiers in microbiology. 2016; 7:547. |
|
