|
|
Marker Overview
| Name | Ov0020 |
|---|
| dbSNP ID | N/A |
|---|
| Type | SNP |
|---|
| SNP Alleles | N/A |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Ov0020.Forward Primer: AGCTGAGATGGCACTGGT |
|---|
| Primer 2 | Ov0020.Reverse Primer: TGGACATAAGATTTGGCAACT |
|---|
| Product Length | 2200 |
|---|
| Restriction Enzyme | SI055;SI143;SI213 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Arab HH, Mohamed WR, Barakat BM, Arafa EA. Tangeretin attenuates cisplatin-induced renal injury in rats: Impact on the inflammatory cascade and oxidative perturbations. Chemico-biological interactions. 2016 Sep 9; 258:205-213. |
|
