|
|
Marker Overview
| Name | Al0223 |
|---|
| Genbank ID | C95277 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Al0223.Forward Primer: GACGTTAACAGCAACCAT |
|---|
| Primer 2 | Al0223.Reverse Primer: AAATTCCGATTATTATTACGA |
|---|
| Restriction Enzyme | NC |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Chung MY, Shin HS, Choi DW, Shon DH. Citrus Tachibana Leaf Extract Mitigates Symptoms of Food Allergy by Inhibiting Th2-Associated Responses. Journal of food science. 2016 Apr 27. |
|
