|
|
Marker Overview
| Name | Bf0189 |
|---|
| Genbank ID | DC886176 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0189.Forward Primer: TGCAGAGAAAGGGGATG |
|---|
| Primer 2 | Bf0189.Reverse Primer: GACTATCTAAAAGCGACCACA |
|---|
| Restriction Enzyme | HhaI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Wang NY, Zhang K, Huguet-Tapia JC, Rollins JA, Dewdney MM. Mating type and simple sequence repeat markers indicate a clonal population of Phyllosticta citricarpa in Florida. Phytopathology. 2016 Jun 27. |
|
