|
|
Marker Overview
| Name | Tf0062 |
|---|
| Genbank ID | CB290239 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Tf0062.Forward Primer: ACTTCATCAGCTGCGACAACT |
|---|
| Primer 2 | Tf0062.Reverse Primer: CGATTGCGTGAAGATTGGTAT |
|---|
| Product Length | 900 |
|---|
| Restriction Enzyme | Rsa1 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Artier J, da Silva Zandonadi F, de Souza Carvalho FM, Pauletti BA, Leme AF, Carnielli CM, de Araujo HS, Bertolini MC, Ferro JA, Júnior JB, de Oliveira JC, Novo-Mansur MT. Comparative proteome analysis of Xanthomonas citri subsp citri periplasmic proteins reveals changes in cellular envelope metabolism during in vitro pathogenicity induction. Molecular plant pathology. 2016 Oct 31. |
|
