|
|
Marker Overview
| Name | Sz0002 |
|---|
| Genbank ID | N/A |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Sz0002.Forward Primer: GGCAGGGAGGATACGG |
|---|
| Primer 2 | Sz0002.Reverse Primer: TGCCCAGTTGAAAGATACTCA |
|---|
| Restriction Enzyme | HinfI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Manzi M, Lado J, Rodrigo MJ, Arbona V, Gómez-Cadenas A. ABA accumulation in water-stressed Citrus roots does not rely on carotenoid content in this organ. Plant science : an international journal of experimental plant biology. 2016 Nov; 252:151-161. |
|
