|
|
Marker Overview
| Name | Sz0004 |
|---|
| Genbank ID | N/A |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Sz0004.Forward Primer: GGTAGGCGATTTAGCATC |
|---|
| Primer 2 | Sz0004.Reverse Primer: GGAACTGCCACATTGATAAGC |
|---|
| Restriction Enzyme | HincII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Bai X, Yang P, Zhou Q, Cai B, Buist-Homan M, Cheng H, Jiang J, Shen D, Li L, Luo X, Faber KN, Moshage H, Shi G. The protective effect of the natural compound hesperetin against fulminant hepatitis in vivo and in vitro. British journal of pharmacology. 2016 Oct 7. |
|
