|
|
Marker Overview
| Name | Al0519 |
|---|
| Genbank ID | C95531 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Al0519.Forward Primer: TGCAAGGCCAGTCATACTTCA |
|---|
| Primer 2 | Al0519.Reverse Primer: GTCATAACCGGCAAGCACAC |
|---|
| Restriction Enzyme | MspI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Ayadi M, Hanana M, Kharrat N, Merchaoui H, Marzoug RB, Lauvergeat V, Rebaï A, Mzid R. The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding. Applied biochemistry and biotechnology. 2016 May 19. |
|
