|
|
Marker Overview
| Name | Al0028 |
|---|
| Genbank ID | C95226 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Al0028.Forward Primer: GTGGACGATGTGCCGATTAGG |
|---|
| Primer 2 | Al0028.Reverse Primer: GCCATGCATCCCGAATAGG |
|---|
| Restriction Enzyme | HindIII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Parkinson JF, Gobin B, Hughes WO. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis. Ecology and evolution. 2016 Apr; 6(7):2053-60. |
|
