|
|
Marker Overview
| Name | Bf0136b |
|---|
| Genbank ID | DC885712 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0136b.Forward Primer: ACACTGACTTCTTGCCATACA |
|---|
| Primer 2 | Bf0136b.Reverse Primer: ACAGAATGTGACGGGAAAC |
|---|
| Restriction Enzyme | HinfI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 1996 | Hong Zheng X, Nishioka M, Kawamura A, Ukeda H, Sawamura M, Kusunose H. Cluster Analysis by Measurement of Peroxidase and Esterase from Citrus Flavedo. Bioscience, biotechnology, and biochemistry. 1996 Jan; 60(3):390-5. |
|
