|
|
Marker Overview
| Name | Bf0147 |
|---|
| Genbank ID | DC885795 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0147.Forward Primer: CCTGCATTGCCTTTATTAGT |
|---|
| Primer 2 | Bf0147.Reverse Primer: ACAAATCTTCCGATACTCACA |
|---|
| Restriction Enzyme | StyI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Mahjbi A, Oueslati A, Baraket G, Salhi-Hannachi A, Zehdi Azouzi S. Assessment of genetic diversity of Tunisian orange, Citrus sinensis (L.) Osbeck using microsatellite (SSR) markers. Genetics and molecular research : GMR. 2016; 15(2). |
|
