|
|
Marker Overview
| Name | Fb0223 |
|---|
| Genbank ID | DC888148 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Fb0223.Forward Primer: CTCCGCTTTAGTTTGTGG |
|---|
| Primer 2 | Fb0223.Reverse Primer: TTTCCGATAGATTTCCTCTTC |
|---|
| Restriction Enzyme | NC |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Wang Y, Zhou L, Yu X, Stover E, Luo F, Duan Y. Transcriptome Profiling of Huanglongbing (HLB) Tolerant and Susceptible Citrus Plants Reveals the Role of Basal Resistance in HLB Tolerance. Frontiers in plant science. 2016; 7:933. |
|
