SCO07, SCO07 (genetic_marker) Citrus spp.

Marker Overview
NameSCO07
Genbank IDN/A
TypeSCAR
SpeciesCitrus spp.
Primer 1SCO07.Forward Primer: CAGCACTGACCAATGTAGAA
Primer 2SCO07.Reverse Primer: CAGCACTGACATGTTTTG
Product Length669
Publication[view all]
ContactFred Gmitter
Courtney Weber
Contact
NameDetails
Fred Gmitter
First name:Fred
Last name:Gmitter
Title:Researcher
Institution:UFL
Address:Institute of Food and Agricultural Sciences,Citrus Research and Education Center, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:fgg@cred.ifas.ufl.edu
Phone:+ 1-863-9561151
Fax:+ 1-863-9564631
Last update:Feb 2007
Courtney Weber
First name:Courtney
Last name:Weber
Title:Researcher
Institution:University of Florida
Address:Horticultural Sciences Department, University of Florida, Gainesville, FL 32611
Country:USA
Email:caw34@nysaes.cornell.edu
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerSCO07.Forward PrimerCitrus spp.primer
Reverse PrimerSCO07.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCO07SCO07Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-USDA1747/Nakon-BC1-2001AN/A13.6SCO07View
2Citrus-DPI6.4/Rubidoux-Rubidoux-F1-2003P3N/A63SCO07View