|
|
Marker Overview
| Name | SCO07 |
|---|
| Genbank ID | N/A |
|---|
| Type | SCAR |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | SCO07.Forward Primer: CAGCACTGACCAATGTAGAA |
|---|
| Primer 2 | SCO07.Reverse Primer: CAGCACTGACATGTTTTG |
|---|
| Product Length | 669 |
|---|
| Publication | [view all] |
|---|
| Contact | Fred Gmitter
Courtney Weber
|
|---|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
| Feature Name | Unique Name | Species | Type |
|---|
| Forward Primer | SCO07.Forward Primer | Citrus spp. | primer |
| Reverse Primer | SCO07.Reverse Primer | Citrus spp. | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
| Feature Name | Unique Name | Species | Type |
|---|
| SCO07 | SCO07 | Citrus spp. | marker_locus |
Publications
| Year | Publication |
|---|
| 1997 | Deng Z, Huang S, Xiao S, Gmitter FJ. Development and characterization of SCAR markers linked to the citrus tristeza virus resistance gene from Poncirus trifoliata. Genome. 1997 Oct; 40(5):697-704. |
| 2001 | Deng Z, Huang S, Ling P, Yu C, Tao Q, Chen C, Wendell M, Zhang H, Gmitter FJ. Fine genetic mapping and BAC contig development for the citrus tristeza virus resistance gene locus in Poncirus trifoliata (Raf.). Molecular genetics and genomics : MGG. 2001 June; 265(4):739-747. |
| 2003 | Weber CA, Moore GA, Deng Z and Gmitter FG. Mapping freeze tolerance quantitative trait loci in a Citrus grandis X Poncirus trifoliata F1 pseudo-testcross using molecular markers. Journal of the American Society for Horticultural Science. 2003. 128:742-751. |
|
