1388, 1388 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	1388
Genbank ID	DY289396
Type	SSR
Species	Citrus spp.
Repeat Motif	(GGA)6
Primer 1	1388.Forward Primer: AAAACAAAGCACCCAGATCG
Primer 2	1388.Reverse Primer: ACGGCAGCAACGAGATAAGT
Product Length	138
Max Length	142
Publication	[view all]
Contact	Patrick Ollitrault Francois Luro

Contact

Name

Details

Patrick Ollitrault

First name:	Patrick
Last name:	Ollitrault
Title:	Researcher
Institution:	CIRAD
Address:	Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:	France
Email:	patrick.ollitrault@cirad.fr
Phone:	+33(0)467615971
Fax:	+33(0)467615666
Last update:	Jun 2020

Francois Luro

First name:	Francois
Last name:	Luro
Title:	Researcher
Institution:	INRA
Address:	1INRA, Unite de Recherche GEQA, INRA San Giuliano, 20230 San Nicolao, France
Country:	France
Email:	luro@corse.inra.fr

Publications


Year	Publication
2007	Fanciullino A, Dhuique-Mayer C, Luro F, Morillon R, Ollitrault P. Carotenoid Biosynthetic Pathway in the Citrus Genus: Number of Copies and Phylogenetic Diversity of Seven Genes. Journal of agricultural and food chemistry. 2007; 55(18):7405-7417.
2008	Luro F, Costantino G, Terol J, Argout X, Allario T, Wincker P, Talon M, Ollitrault P, and Morillon R. (2008). Transferability of the EST-SSRs developed on Nules clementine (Citrus clementina Hort ex Tan) to other Citrus species and their effectiveness for genetic mapping. BMC Genomics. 2008. 9(1):287.