CAC33, CAC33 (genetic_marker) Citrus spp.

Marker Overview
NameCAC33
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifCAC
Primer 1CAC33.Forward Primer: GGTGATGCTGCTACTGATGC
Primer 2CAC33.Reverse Primer: CAATTGTGAATTTGTGATTCCG
Publication[view all]
ContactA. Nematollahi
Behrouz Golein
Osman Gulsen
M Thomas
Qi-bin Hong
Contact
NameDetails
A. Nematollahi
First name:A.
Last name:Nematollahi
Title:Researcher
Institution:College of Abouraihan
Address:Department of Horticulture, College of Abouraihan, University of Tehran, Tehran, Iran
Country:Iran
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
Osman Gulsen
First name:Osman
Last name:Gulsen
Title:Researcher
Institution:Erciyes University, Turkey
Address:Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:Turkey
Email:o_gulsen@yahoo.com
Phone:+90 352 4374901
Fax:+90 352 4376902
M Thomas
First name:M
Last name:Thomas
Institution:CSIRO
Address:CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCAC33.Forward PrimerCitrus spp.primer
Reverse PrimerCAC33.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SSRCAC33.200SSRCAC33.200Citrus spp.marker_locus
CAC33CAC33Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Orlando/Clementine-F1-Orlando-2010Orl-1N/A117SSRCAC33.200View
2Citrus-Li2/Wan2-F1-2015LG2N/A61.2CAC33View