LTR4, LTR4 (genetic_marker) Citrus spp.

Marker Overview
NameLTR4
Genbank IDN/A
TypeSSAP
SpeciesCitrus spp.
Primer 1LTR4.Forward Primer: CCAATTCCGGAAGGTTCTAGG
Publication[view all]
ContactXiuxin Deng
Contact
NameDetails
Xiuxin Deng
First name:Xiuxin
Last name:Deng
Title:Researcher
Institution:Huazhong Agricultural University
Address:National Key Laboratory of Crop Genetic Improvement, College of Horticulture and Forestry Science, Huazhong Agricultural University, Wuhan, 430070, P.R. China
Country:China
Email:xxdeng@mail.hzau.edu.cn
Phone:+86 27 87286906
Fax:+86 27 87280016
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerLTR4.Forward PrimerCitrus spp.primer