|
Marker Overview
Name | FLS |
Genbank ID | AB011796 |
Type | gene marker |
Species | Citrus spp. |
Primer 1 | FLS.Forward Primer: GGAGGTGGAGAGGGTCCAAG |
Primer 2 | FLS.Reverse Primer: GGGCCACCACTCCAAGAGC |
Publication | [view all] |
Contact | Patrick Ollitrault
|
Publications
Year | Publication |
2013 | Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species. Annals of botany. 2013 Jan; 111(1):1-19. |
2012 | Ollitrault, P, Terol, J, Chen, C, Federici, CT, Lotfy, S, Hippolyte, I, Ollitrault, F, Bérard, A, Chauveau, A, Cuenca, J, Costantino, G, Kacar, Y, Mu, L, Garcia-Lor, A, Froelicher, Y, Aleza, P, Boland, A, Billot, C, Navarro, L, Luro, F, Roose, ML, Gmitter, FG, Talon, M, and Brunel, D. A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping. BMC Genomics. 2012. 13:593. |
|