35S forward, 35S forward (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	35S forward
Genbank ID	N/A
Type	genetic marker
Species	Citrus spp.
Primer 1	35S forward.Forward Primer: aacatggtggagcacgacac
Publication	[view all]
Contact	Doron Holland

Contact

Name

Details

Doron Holland

First name:	Doron
Last name:	Holland
Title:	Researcher
Address:	Department of Fruit Culture, Newe-Ya'ar Research Center, Agricultural Research Organization, POB 1021, Ramat Yishay 30095 Israel
Country:	Israel
Email:	vhhollan@agri.gov.il

Publications


Year	Publication
2005	Trainin T, Lipsky A, Levy A, Holland D. Prolonged somatic transposition in citrus: The autonomous Ac transposable element remains active in the citrus genome for several years. Journal of the American Society for Horticultural Science. 2005; 130(1):95-101.