|
Marker Overview
Name | Fb0138 |
Genbank ID | DC888053 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Fb0138.Forward Primer: AAAGCGGCAAAAGATGTTATT |
Primer 2 | Fb0138.Reverse Primer: GTTTGGGAAGTGGGTGAG |
Product Length | 1000 |
Restriction Enzyme | Dra1 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Dwivedi UN, Tiwari S, Prasanna P, Awasthi M, Singh S, Pandey VP. Citrus Functional Genomics and Molecular Modeling in Relation to Citrus sinensis (Sweet Orange) Infection with Xylella fastidiosa (Citrus Variegated Chlorosis). Omics : a journal of integrative biology. 2016 Jul 22. |
|