|
Marker Overview
Name | Mf0072 |
Genbank ID | C81844 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Mf0072.Forward Primer: GCCGTACATCAGGCATCATAT |
Primer 2 | Mf0072.Reverse Primer: TCACAAGAAAGCCATTGAAGC |
Product Length | 800 |
Restriction Enzyme | Hae3 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Kleynhans J, Pietersen G. Comparison of multiple viral population characterization methods on a candidate cross-protection Citrus tristeza virus (CTV) source. Journal of virological methods. 2016 Sep 3. |
|