|
Marker Overview
Name | Fb0207 |
Genbank ID | DC888127 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Fb0207.Forward Primer: TCCTTTATGATTTTGCCTTTT |
Primer 2 | Fb0207.Reverse Primer: GACTATCAGCTCCCCATCTT |
Restriction Enzyme | HhaI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Jukes MD, Motsoeneng BM, Knox CM, Hill MP, Moore SD. The comparative analysis of complete genome sequences from two South African betabaculoviruses: Phthorimaea operculella granulovirus and Plutella xylostella granulovirus. Archives of virology. 2016 Jul 25. |
|