|
|
Marker Overview
| Name | Ov0116 |
|---|
| Genbank ID | AU186411 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Ov0116.Forward Primer: GTGTGAAAGCCGCTGTT |
|---|
| Primer 2 | Ov0116.Reverse Primer: AATCATTTAATACCCGCAGAG |
|---|
| Restriction Enzyme | DraI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Yu S, Ding L, Luo R, Li X, Yang J, Liu H, Cong L, Ran C. Identification of Immunity-Related Genes in Dialeurodes citri against Entomopathogenic Fungus Lecanicillium attenuatum by RNA-Seq Analysis. PloS one. 2016; 11(9):e0162659. |
|
