GT03, GT03 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	GT03
Genbank ID	N/A
Type	SSR
Species	Citrus spp.
Repeat Motif	GT
Primer 1	GT03.Forward Primer: GCCTTCTTGATTTACCGGAC
Primer 2	GT03.Reverse Primer: TGCTCCGAACTTCATCATTG
Publication	[view all]
Contact	Noelle Barkley Sergio Ferrante Behrouz Golein Osman Gulsen MJ Asins Qi-bin Hong

Contact

Name

Details

Noelle Barkley

First name:	Noelle
Last name:	Barkley
Title:	Researcher
Institution:	University of California, Riverside
Address:	Department of Botany and Plant Sciences and Graduate Program in Genetics, Genomics, and Bioinformatics, University of California, Riverside, USA
Country:	USA
Email:	nbarkley@ars-grin.gov
Phone:	+1-770-4124035
Fax:	+ 1-770-2293323

Sergio Ferrante

First name:	Sergio
Last name:	Ferrante
Title:	Researcher
Institution:	Institute of Plant Genetics (Research Division of Palermo)
Address:	CNR—Institute of Plant Genetics (Research Division of Palermo), Corso Calatafimi 414, 90129 Palermo, Italy
Country:	Italy
Email:	sergiopietro.ferrante@igv.cnr.it

Behrouz Golein

First name:	Behrouz
Last name:	Golein
Title:	Researcher
Institution:	Iran Citrus Research Institute
Address:	Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:	Iran
Email:	bgoleincitrus@yahhoo.com
Phone:	+98 9113945261
Fax:	+98 1925223282

Osman Gulsen

First name:	Osman
Last name:	Gulsen
Title:	Researcher
Institution:	Erciyes University, Turkey
Address:	Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:	Turkey
Email:	o_gulsen@yahoo.com
Phone:	+90 352 4374901
Fax:	+90 352 4376902

MJ Asins

First name:	MJ
Last name:	Asins
Title:	Researcher
Institution:	IVIA
Address:	Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:	Spain
Email:	mjasins@ivia.es
Fax:	+34-961390240

Qi-bin Hong

First name:	Qi-Bin
Last name:	Hong
Title:	Researcher
Institution:	Chinese Academy of Agricultural Sciences/Southwest University
Address:	Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:	China
Email:	hongqb@sina.com

Publications


Year	Publication
2010	Ferrante SP, Lucretti S, Reale S, De Patrizio A, Abbate L, Tusa N, Scarano M. Assessment of the origin of new citrus tetraploid hybrids (2n = 4x) by means of SSR markers and PCR based dosage effects. Euphytica. 2010; 173(2):223-233.
2006	Barkley N, Roose M, Krueger R, Federici C. Assessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs). Theoretical and applied genetics. 2006; 112(8):1519-1531.
2012	Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2010	Gulsen O, Uzun A, Canan I, Seday U, Canihos E. A new citrus linkage map based on SRAP, SSR, ISSR, POGP, RGA and RAPD markers. Euphytica. 2010; 173(2):265-277.
2012	Raga V, Bernet GP, Carbonell EA, Asíns MJ. Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genetics and Genomes. 2012; 8(5):1061-1071.
2015	Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Citrus-Orlando/Clementine-F1-Orlando-2010	Orl-9	N/A	16	SSRGT03.149	View
2	Citrus-Cleopatra/Trifoliatesp-F2-2012	RPr4a	N/A	25	GT03, 180	View
3	Citrus-Li2/Wan2-F1-2015	LG7	N/A	2.6	GT03	View