|
|
Marker Overview
| Name | Bf0123 |
|---|
| dbSNP ID | N/A |
|---|
| Type | SNP |
|---|
| SNP Alleles | N/A |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0123.Forward Primer: CCTGCCCTTGGTATCAAAAAG |
|---|
| Primer 2 | Bf0123.Reverse Primer: CACCACAGGAATGCCAGAAG |
|---|
| Product Length | 2400 |
|---|
| Restriction Enzyme | SI141 |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
Mitsuo Omura
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2016 | Lee J, Yang DS, Han SI, Yun JH, Kim IW, Kim SJ, Kim JH. Aqueous Extraction of Citrus unshiu Peel Induces Proangiogenic Effects Through the FAK and ERK1/2 Signaling Pathway in Human Umbilical Vein Endothelial Cells. Journal of medicinal food. 2016 Jun; 19(6):569-77. |
|
